newbie at java need help with filescanner?

[redapples]

i would like to read a file and display its contents up to a certain line and the number of lines is not fixed, currently i only know how to display a fixed number of lines.

example of the text file is
>gi|514210|gb|A19638|Influenza virus type A mRNA for haemagglutinin internal fragment
CCTACTGGTCCTGTTATGTGCACTTGCAGCTGCAGATGCAGACACAATATGTATAGGCTACCATGCGAAC
>gi|6092754|gb|A79849|Sequence 6 from Patent WO9637624.
TAAAAAAACCTATAAATAATGCCCTTGTACAAATTGTTAAACGTTTTGTGGTTGGTCGCCGTTTCTAACG

Scanner s = new Scanner(new FileReader("hello.txt"));
Scanner a = s;

a.findWithinHorizon(feet,0);
if (a.hasNext())
{
for(int q = 0; q<15; q++)
System.out.println(a.nextLine());
}

 

[covinher]

You can change your for loop to a while loop, but you'll have to choose a condition:

boolean done = false
while (a.hasNext() && !done) {
String line = a.nextLine()
System.out.println(line);
/* stop when we get to sequence 6 */
if (line.indexOf("Sequence 6") != -1) {
done = true;
}
}